Establishment of a mouse model with Ddx24 conditional knock out in vascular endothelial cell and retina angiogenesis analysis

doi:10.3877/cma.j.issn.2095-5782.2022.04.016

Chinese Journal of Interventional Radiology(Electronic Edition) ›› 2022, Vol. 10 ›› Issue (04): 429-435. doi: 10.3877/cma.j.issn.2095-5782.2022.04.016

• Imaging Diagnose • Previous Articles Next Articles

Establishment of a mouse model with Ddx24 conditional knock out in vascular endothelial cell and retina angiogenesis analysis

Bing Li¹, Hairun Gan², Jianxun Cai², Haoyu Long², Luting Li²^,^†()

^1. Department of Ophthalmology,; Guangdong Provincial Key Laboratory of Biomedical Imaging,; Guangdong Provincial Engineering Research Center of Molecular Imaging, the Fifth Affiliated Hospital, Sun Yat-sen University, Guangdong Zhuhai 519000, China
^2. Center for Interventional Medicine,; Guangdong Provincial Key Laboratory of Biomedical Imaging,; Guangdong Provincial Engineering Research Center of Molecular Imaging, the Fifth Affiliated Hospital, Sun Yat-sen University, Guangdong Zhuhai 519000, China

Received:2022-05-10 Online:2022-11-25 Published:2022-12-15
Contact: Luting Li

Abstract

Abstract:

Objective

To establish vascular endothelial specific knockout of Ddx24 mice (Cdh5-Cre × Ddx24^flox/flox) and explore the effect of Ddx24 gene on embryos development and retina neovascularization, so as to provide a model for investigating the functional role of DDX24 gene in visceral vascular malformation and specific molecular mechanism.

Methods

The flox-labeled mice with Ddx24 gene were established by using Cre-LoxP system and mated with Cdh5-Cre mice expressing Cre enzyme specifically in vascular endothelium for establishing Cdh5-Cre × Ddx24^flox/flox mice. PCR and agarose gel electrophoresis were used for genotyping. Western blot or qPCR assay was used to observe the expression changes of DDX24 in vascular of Cdh5-Cre × Ddx24^flox/flox. H&E-stained or immunofluorescence was used to observe the changes of embryos development and retina neovascularization in Cdh5-Cre × Ddx24^flox/flox.

Results

Cdh5-Cre × Ddx24^flox/flox were successfully established. Western blot and qPCR assay showed that the levels of DDX24 were decreased in the vascular tissue of Cdh5-Cre × Ddx24^flox/flox. Vascular endothelial specific knockout of Ddx24 does not lead to embryonic death but result in abnormally increased retinal neovascularization.

Conclusions

The study successfully established Cdh5-Cre × Ddx24^flox/flox mice using Cre-LoxP technique. Vascular endothelial specific knockout of Ddx24 could result in abnormally increased retinal neovascularization. Therefore, this animal model laid the foundation for exploring the functional role of DDX24 gene in visceral vascular malformation.

Key words: Ddx24, Cre-LoxP, Retinal neovascularization, Visceral vascular malformation

Bing Li, Hairun Gan, Jianxun Cai, Haoyu Long, Luting Li. Establishment of a mouse model with Ddx24 conditional knock out in vascular endothelial cell and retina angiogenesis analysis[J]. Chinese Journal of Interventional Radiology(Electronic Edition), 2022, 10(04): 429-435.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhjrfsxdzzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.2095-5782.2022.04.016

https://zhjrfsxdzzz.cma-cmc.com.cn/EN/Y2022/V10/I04/429

Figures/Tables 6

References 21

[1]	Ernemann U, Kramer U, Miller S, et al. Current concepts in the classification, diagnosis and treatment of vascular anomalies[J]. Eur J Radiol, 2010, 75(1): 2-11.
[2]	Wassef M, Blei F, Adams D, et al. Vascular anomalies classification: recommendations from the International Society for the Study of Vascular Anomalies[J]. Pediatrics, 2015, 136(1): e203-e214.
[3]	Greene AK. Vascular anomalies: current overview of the field[J]. Clin Plast Surg, 2011, 38(1): 1-5.
[4]	Tyraskis A, Durkin N, Davenport M. Congenital vascular anomalies of the liver[J]. S Afr Med J, 2017, 107(10): 12130.
[5]	Davenport M. Congenital vascular malformations of the lLiver: an association with trisomy 21[J]. J Pediatr Gastroenterol Nutr, 2017, 64(3): e82.
[6]	Pang PP, Hu XJ, Zhou B, et al. DDX24 mutations associated with malformations of major vessels to the viscera[J]. Hepatology, 2019, 69(2): 803-816.
[7]	Ma Z, Moore R, Xu XX, et al. DDX24 negatively regulates cytosolic RNA-mediated innate immune signaling[J]. PLoS Pathog, 2013, 9(10): e1003721.
[8]	Ma YW, Yu L, Pan S, et al. CRISPR/Cas9-mediated targeting of the Rosa26 locus produces Cre reporter rat strains for monitoring Cre-loxP-mediated lineage tracing[J]. Febs j, 2017, 284(19): 3262-3277.
[9]	Karginov FV, Hannon GJ. The CRISPR system: small RNA-guided defense in bacteria and archaea[J]. Mol Cell, 2010, 37(1): 7-19.
[10]	Liu TZ, Long Q, Li LL, et al. The NRF2-dependent transcriptional axis, XRCC5/hTERT drives tumor progression and 5-Fu insensitivity in hepatocellular carcinoma[J]. Mol Ther Oncolytics, 2022, 24: 249-261.
[11]	Tual-Chalot S, Allinson KR, Fruttiger M, et al. Whole mount immunofluorescent staining of the neonatal mouse retina to investigate angiogenesis in vivo[J]. J Vis Exp, 2013, (77): e50546.
[12]	Denier C, Labauge P, Bergametti F, et al. Genotype-phenotype correlations in cerebral cavernous malformations patients[J]. Ann Neurol, 2006, 60(5): 550-556.
[13]	Wouters V, Limaye N, Uebelhoer M, et al. Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects[J]. Eur J Hum Genet, 2010, 18(4): 414-420.
[14]	Gordon K, Schulte D, Brice G, et al. Mutation in vascular endothelial growth factor-C, a ligand for vascular endothelial growth factor receptor-3, is associated with autosomal dominant milroy-like primary lymphedema[J]. Circ Res, 2013, 112(6): 956-960.
[15]	Brouillard P, Boon LM, Mulliken JB, et al. Mutations in a novel factor, glomulin, are responsible for glomuvenous malformations ("glomangiomas")[J]. Am J Hum Genet, 2002, 70(4): 866-874.
[16]	Boon LM, Mulliken JB, Vikkula M. RASA1: variable phenotype with capillary and arteriovenous malformations[J]. Curr Opin Genet Dev, 2005, 15(3): 265-269.
[17]	Linder P, Jankowsky E. From unwinding to clamping - the DEAD box RNA helicase family[J]. Nat Rev Mol Cell Biol, 2011, 12(8): 505-516.
[18]	Linder P, Fuller-Pace FV. Looking back on the birth of DEAD-box RNA helicases[J]. Biochim Biophys Acta, 2013, 1829(8): 750-755.
[19]	Frutkin AD, Shi H, Otsuka G, et al. A critical developmental role for tgfbr2 in myogenic cell lineages is revealed in mice expressing SM22-Cre, not SMMHC-Cre[J]. J Mol Cell Cardiol, 2006, 41(4): 724-731.
[20]	Wang Y, Cao Y, Yamada S, et al. Cardiomyopathy and worsened ischemic heart failure in SM22-α cre-mediated neuropilin-1 null mice: dysregulation of PGC1α and mitochondrial homeostasis[J]. Arterioscler Thromb Vasc Biol, 2015, 35(6): 1401-1412.
[21]	Hong J, Liu RL, Chen LW, et al. Conditional knockout of tissue factor pathway inhibitor 2 in vascular endothelial cells accelerates atherosclerotic plaque development in mice[J]. Thromb Res, 2016, 137: 148-156.

引物名称	引物序列
Ddx24-tF1	AGGGAGATGTAGACCCAGGGAG
Ddx24-tR1	CCCAGAGTGGGCACATACAAG
Cdh5-Cre-tF1	TCAGCGTTCAGACTCCTCAGAATGT
Cdh5-Cre-tR1	GAGGACAGGAACCTAAATGCTATGC

引物名称	引物序列
Ddx24-tF1	AGGGAGATGTAGACCCAGGGAG
Ddx24-tR1	CCCAGAGTGGGCACATACAAG
Cdh5-Cre-tF1	TCAGCGTTCAGACTCCTCAGAATGT
Cdh5-Cre-tR1	GAGGACAGGAACCTAAATGCTATGC

序号	温度（℃）	时间	循环数
1	95	05 min
2	95	30 s
3	60	30 s
4	72	30 s	2~4，30X
5	72	03 min
6	10	Hold

序号	温度（℃）	时间	循环数
1	95	05 min
2	95	30 s
3	60	30 s
4	72	30 s	2~4，30X
5	72	03 min
6	10	Hold

Please choose a citation manager

Content to export

Establishment of a mouse model with Ddx24 conditional knock out in vascular endothelial cell and retina angiogenesis analysis

RichHTML

PDF (PC)

Knowledge